Home | About PM | Editorial board | Search | Ahead of print | Current Issue | Archives | Instructions | Subscribe | Advertise | Contact us |  Login 
Pharmacognosy Magazine
Search Article 
  
Advanced search 
 

 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2021  |  Volume : 17  |  Issue : 73  |  Page : 193-199  

Eriocitrin alleviates the arterial occlusion-mediated cerebral ischemic-reperfusion injury through the modulation of apoptotic proteins and immune markers in mice


1 Department of Intensive Care Unit, Affiliated Hospital of Beihua University, Jilin city, Jilin Province, 132011, P.R. China
2 Department of Rehabilitation, Shanghai Putuo People's Hospital, Putuo People's Hospital Affiliated to Tongji University, Department of Rehabilitation, Shanghai Putuo People's Hospital, Shanghai, 200060, P.R. China
3 Department of Pharmacy, Zhangzhou Hospital Affiliated to Fujian Medical University, Zhengzhou, Fujian, 363000, P.R. China
4 Department of Rehabilitation Medicine, The 910th Hospital of the Joint Logistics Support Force of the Chinese People's Liberation Army, Quanzhou, 362000, P.R. China

Date of Submission01-Jan-2020
Date of Decision26-Feb-2020
Date of Acceptance11-Aug-2020
Date of Web Publication15-Apr-2021

Correspondence Address:
Weixiang Xue
Department of Rehabilitation Medicine, The 910th Hospital of the Joint Logistics Support Force of the Chinese People's Liberation Army, Quanzhou 362000
P.R. China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/pm.pm_577_19

Rights and Permissions
   Abstract 


Background: Stroke is ranked on top of the persistent ailments associated with the brain. The incidence of ischemic stroke is rapidly rising along with intensified mortality as well as permanent disability conditions. However, tissue plasminogen activator (tissue-type plasminogen activator) is the only FDA-approved treatment for the treatment of stroke with decreased success rate. Eriocitrin, a flavonoid compound of Citrus limon with incredible therapeutic values, was active in the current investigation to explore the neuroprotective capability in arterial occlusion-provoked cerebral ischemic reperfusion injury (CIRI) in mouse replica. Materials and Methods: The neurological defects were considered through the standard scoring method and the expression status of apoptotic proteins, i.e., nuclear factor kappa B (NF-ƙB), caspase-3, and caspase-9, was examined via western blotting test. The expression of neuronal nitric oxide synthase (nNOS) was scrutinized through real-time polymerase chain reaction and standard ELISA kits were employed to examine the status of the proinflammatory markers. Results: The arterial occlusion provoked cerebral ischemic animals displayed the severely elevated status of inflammatory markers namely interleukin-6 (IL-6), IL-1β and tumor necrosis factor α, and the expression statuses of apoptotic proteins, as well as nNOS, were also uplifted while comparing to the sham subjected animals. Amazingly, eriocitrin (100 mg/kg) treatment revealed the declined inflammatory markers level, besides, the expression patterns of apoptotic proteins and nNOS were also reduced noticeably in the cerebral ischemic-reperfusion-operated animals. Conclusion: The novel findings of this investigation were demonstrated that the Eriocitrin delivered an astounding neuroprotection in the arterial occlusion-mediated CIRI in mouse replica, which possibly a promising neuroprotectant in cerebral ischemia.

Keywords: Arterial occlusion, cerebral ischemia, eriocitrin, inflammatory markers, reperfusion, stroke


How to cite this article:
Duan X, Hao Y, Liang X, Qiu G, Xue W. Eriocitrin alleviates the arterial occlusion-mediated cerebral ischemic-reperfusion injury through the modulation of apoptotic proteins and immune markers in mice. Phcog Mag 2021;17:193-9

How to cite this URL:
Duan X, Hao Y, Liang X, Qiu G, Xue W. Eriocitrin alleviates the arterial occlusion-mediated cerebral ischemic-reperfusion injury through the modulation of apoptotic proteins and immune markers in mice. Phcog Mag [serial online] 2021 [cited 2021 May 9];17:193-9. Available from: http://www.phcog.com/text.asp?2021/17/73/193/313544



SUMMARY

  • The cerebral ischemia-reperfusion injury is a harsh ailing condition of the brain which often results in severe neural afflictions and irrevocable neural necrosis
  • Eriocitrin treatment ameliorated the too much expressions of apoptotic proteins that is (p) nuclear factor kappa B, caspase-3 and caspase-9 in the cerebral ischemic-reperfusion animals.




Abbreviations Used: tPA: Tissue plasminogen activator; TLR: 4-toll-like receptor; CIRI: Cerebral ischemic reperfusion injury; nNOS: Neuronal nitric oxide synthase.


   Introduction Top


An ischemic stroke is a critical illness that results in incurable physiological inabilities as well as fatality; it was caused through the unforeseen blocking of cerebral blood supply along with consequent neural cell necrosis. The occlusion of carotid arteries which carries the blood to the major portions of the brain along with the successive reperfusion is the pivotal feature of the pathological progression of ischemic stroke. Stroke accounted for the second most reason for permanent physical disabilities as well as death worldwide. A recent report from the World Health Organization stated that every year, >15 million individuals are affected from stroke worldwide, among them almost 6 milling stroke victims died and over half of survivors are living with incurable physical disabilities.[1],[2],[3],[4] Stroke ranked on top among the recurrent cerebrum associated ailments. Stroke also placed on second between the incurable ailments as well as first on disabling or incapacitating diseases throughout the world. The hypoxic-ischemic stroke accounted for over 70%–85% of the whole incidences of strokes. Ischemic stroke directs to the injury of brain cells as well null function of malfunction as an outcome of unpredicted immediate interference of brain blood vessels.[1],[5]

The cerebral ischemic brain injury was triggered through the disarrays of blood flow and oxygen delivery to cerebrum, in addition it is a major common cause of brain damage that can escorts to the irreparable or enduring mental disabilities, e.g., malfunction of cognition, cerebral palsy and epilepsy as well as physical difficulties, in some cases it may end with death.[6] If on any occasion, the inclined portions of the brain tissue, like the CA1 segment of the hippocampus were dented that leads to the mutilation of cognition whether in both humans as well as animals.[7] The inflammation at neurons accounted as an essential provider for the pathological process of ischemic brain injury. Extensive research investigations were signified that the momentous actions of the immune cells were endorsed damage of brain tissue as well successive repairing of brain cells and amending in assorted levels of ischemic brain injury.[8],[9] A broad research finding highlighted challenges that the tensed neurons have a capable of stimulating the microglial cells along with encouraging the discharge of pro-inflammatory mediators, those can donate to the progressive secondary neuronal as well oligodendroglial damage.[10],[11]

Inflammation is a very complicated mediator at the pathological process of cerebrum infarction. Inflammation is regarded as an essential arbitrator that can direct to brain cells injury followed to the ischemic stroke. The stimulation of transcriptional moderators is able to initiate the inflammatory reactions that sequentially directs to the discharging of widespread pro-inflammatory mediators.[12] The nuclear factor kappa B (NF-ƙB) is a major transcriptional modulator of inflammation as well as, the activation of the NF-ƙB transcriptional pathway is regarded as a major factor in the stimulation of inflammation on neurovascular units.[13] The heterodimer complexes of NF-ƙB p50/p65 along with their inhibitory mediator specifically IƙBα beneath the usual state and becomes an inactive state at the cytoplasm. Subsequently, the damage of ischemic cerebral reperfusion, the IκB kinase-β quickly gets phosphorylated and triggered for persuading to IκBα phosphorylation thereby degradation. Accordingly, p50/p65 dimers were discharged as well as carried to the nucleus thereafter it endorsed the expression of pro-inflammatory moderators, for instance, tumor necrosis factor α (TNF-α) and interleukin-1β (IL-1β).[4]

The cerebral ischemic stroke can begin toward the deprived oxygen deliver or cerebral hypoxia and later cause the severe injury to the central nervous system (CNS). The reperfusion on the ischemic brain directs toward the surge of pathological progression which results in secondary injuries and accounted to the ischemic reperfusion injury.[14] Progression from ischemic brain injury is mainly associated with the inflammation; free radicals mediated neural damages and excitotoxicity.[15] The preclinical and clinical experimentations were showed that status of oxidative stress markers and inflammatory mediators were surprisingly elevated in the ischemic stroke condition as well. The TNF-α, IL-6, and IL-1 are few of the most distinguished cytokines in the pathogenesis of ischemic stroke.[16],[17]

The medication of tissue plasminogen activator (tPA) is the only recognized and approved drug by the USFDA for the efficient therapy to treat the stroke. It also accountable for their some superfluous effects like chances to hemorrhage at intra-cerebrum and restricted thrombolytic time consumption. It has been reported that only 3%–5% of stroke victims were actually benefited by tPA.[18] The NF-ƙB and toll-like receptor-4 was regarded as to assist the inflammation reaction in the ischemic cerebrum and infarction.[19],[20] The initiation of expression of pro-inflammatory mediators, for instance, TNF-α, IL-1β, IL-6, and NO was stimulated through these signals, which donates to the ischemic stroke.[19] Thereby, the repression of those inflammatory signs regulated through NF-ƙB can be a auspicious strategy for the healing of ischemic stroke.[21] The preceding literature mentioned the neuroprotective potential of citrus flavonoids.[22] Eriocitrin is a flavonoid compound of Citrus limon which influenced the numerous therapeutic values. Eriocitrin possessed anti-inflammatory, antioxidant and anti-hepatoxicity activities.[23],[24],[25] Even though there is null evidence for proving the curative powerful of eriocitrin in cerebral ischemic-reperfusion damages. Thereby, this current investigation was envisioned to explore the therapeutic values of eriocitrin on arterial occlusion-mediated cerebral ischemia-reperfusion in mice.


   Materials and Methods Top


Drugs

All chemicals including eriocitrin, analytical reagents, ELISA kits, and other diagnostic kits were commercially bought from the Sigma-Aldrich, St. Louis (USA) and used for this study.

Experimental Animals

The 7-week-old male C57BL/6J mice (weighing from 22 to 25 g) were bought from Institutional Animal House and sustained in the polypropylene confines beneath the good lab conditions (26°C ± 1°C, 60%–70% air wetness, and 12 h light and dark sequence). Animals were fed with a regular pellet diet with ad libitum. All animals were adapted to laboratory situations for up to 7 days before experimentation. The study was carried out according to the procedures of the Institutional animal ethics committee (2019-071).

Surgical method and experimental setup

The cerebral ischemic-reperfusion was proficient by adopting the procedure given by Ni et al.[26] Initially, the animals were anesthetized through injecting the 60 mg/kg of ketamine and 90 mg/kg of xylazine via intra-peritoneal route. Afterward, the central region of the neck was notched and then the bilateral carotid arteries were identified and separated. Cerebral ischemic condition was initiated through the occlusion of carotid arteries along with surgical loops for 1 h. Followed by 25 min, the cerebral ischemia-reperfusion was stimulated by taking away the loops from arteries. Body temperature of the investigational animals were kept constant at 37°C by using thermostatically controlled heating blanket till the mice improved from the surgery. The sham mice were subjected to identical surgery without the occlusion of arteries. Surgical actions were done through sterile principles.

The mice were randomly alienated into 3 groups along with 12 mice in each. Group-I supplied as sham-subjected with saline treatment. Group-2 was cerebral ischemic-reperfusion stimulated group through occlusion of carotid arteries followed by reperfusion for 24 h. Group-III was cerebral ischemic-reperfusion stimulated and treated with 100 mg/kg[24] of eriocitrin through oral gavage route on 30 min later of initiation of reperfusion and after 12 h the second dose of Eriocitrin (100 mg/kg) was supplemented through the same route. After 24 h reperfusion injury, the anesthetized animals were killed through cervical displacement and the brain portions were separated from animals and processed quickly with saline buffer and stored at 4°C for additional biochemical and histopathological examinations.

Determination of neurological defects

The neurological defects of animals were measured after 24 h of cerebral ischemic-reperfusion stimulation and it was according to score ranging from five points (0–5) scale, where, 0 means null defects, 1 means defect in extension of forelimb, 2 means cannot extend the forelimb, 3 means slight circling, 4 means harsh circling and 5 means lessening towards bilateral side.[27] The higher score representing the harshness of neural defects, all experimental mice were assessed through and the scores were noted.

Determination of inflammatory cytokine level

The status of inflammatory mediators, namely TNF-α, IL-1β, and IL-6 in the brain tissues were measured through ELISA kits (BioCompare, USA) according to the manufacturer's guidelines.

Quantitative real-time polymerase chain reaction study

The whole RNA was extracted from the hippocampus tissues of the brain later than 24 h of reperfusion with the aid of commercial RNA extracting kit (ZymoResearch, Irvine, CA) based on the manufacturer's protocol. The purified RNA samples were employed for the manufacturing of the cDNA with the aid of the cDNA synthesis kit (Takara, Japan). Afterward, real-time polymerase chain reaction (RT-PCR) was performed through a commercial PCR kit (Invitrogen Life Technologies) according to the manufacturer's protocol. The utilized primers for the detection of neuronal nitric oxide synthase (nNOS) is 5'GTGGCCATCGTGTCCTACCATAC3' (forward) and 5'GTTTCGAGGCAGGTGGAAGCTA3' (reverse), for detection of β-actin is 5'CCGTTTCTCCTGGCTCAGTTTA3' (forward) and 5'CCCCAATACCACATCATCCAT3' (reverse). The endogenous β-actin gene was utilized as a reference and for the negative control, water excepting DNA was used. All reactions were done in triplicate.

Western blot study

The brain hippocampus tissues were homogenized with saline and spun at 9000 rpm for 6 min to remove the debris, and the resulting supernatant was subjected to whole protein extraction from with the aid of commercial protein extracting kit (Merck Millipore, USA) based on manufacturer protocol. Afterward, protein was purified through SDS-PAGE technique. The separated protein was transferred to nitrocellulose membrane then blocked along with the 5% dry fat-free milk for 3 h, subsequently the membrane was incubated for up to overnight in 4°C along with relevant primary antibodies for caspase-3, caspase-9, NFƙB and pNFƙB (Boster Bio, CA). In the end, developed bands after addition to the chemiluminescence agent were imagined and documented with the aid of automated software (Biorad Lab, CA, US).

Statistical analysis

All the data were considered statistically through SPSS software (version 19), SPSS Inc., Chicago, IL. The results were analyzed through one-way ANOVA after Dunnett's post hoc test and they were depicted as mean ± SD. P value (P < 0.05) was regarded as statistically significant.


   Results Top


Eriocitrin ameliorates the cerebral ischemic reperfusion injury mediated neurological deficits in mice

The mice subjected to Cerebral Ischemic Reperfusion Injury (CIRI) have showed the distinctive neural defects, as well the forelimb of CIRI animals was completely paralyzed while comparing to the sham-subjected group. [Figure 1] proving that eriocitrin substantially protected the animals from CIRI mediated neurological defects. They tested mice supplemented with 100 mg/kg of Eriocitrin were showed a marked amelioration (P < 0.05) in the recovering of neural deficits induced by CIRI. The CIRI subjected mice confirmed distinct signs of neural dysfunction, while the sham group displayed null neurological complications [Figure 1]. As a result, it is clear that eriocitrin markedly exhibited the marked neuroprotective potential in CIRI subjected animals.
Figure 1: Protective effect of Eriocitrinon Cerebral Ischemic Reperfusion Injury based on neurological deficit score in experimental mice. Data were presented as mean ± standard devitation. A P ≤ 0.05 was considered statistically significant. Comparisons: *with Sham; # with Cerebral Ischemic Reperfusion

Click here to view


Eriocitrin attenuates the elevated expression of neuronal nitric oxide synthase in the cerebral ischemic reperfusion injury mice model

The status of nNOS expression was studied through the RT PCR. The sham group presented a normal expression level of mRNA of nNOS, conversely, the CIRI subjected group disclosed the drastic elevation in the expression level of nNOS. [Figure 2] evidencing that eriocitrin ameliorated the CIRI regulated nNOS expression level while comparing it to the CIRI subjected group. The supplementation of 100 mg/kg of Eriocitrin revealed the astoundingly attenuates the uplifted nNOS expression status, which was mediated by the cerebral ischemic condition. It proved that the Eriocitrin has the therapeutic potential towards cerebral ischemia.
Figure 2: Expression levels of neuronal nitric oxide synthase mRNA in experimental groups of mice. ΔCt = Ct (nNOS) - Ct (β-actin), where Ct = cycle threshold, β-actin is the endogenous reference gene. Relative nNOS mRNA expression: PΔCt = 2ΔCt, representing nNOS mRNA levels. Final data in the graph were magnified to 1000 × 2ΔCt. Data were reported as mean ± standard devitation. A P ≤ 0.05 (two-tailed Student's t-test). Comparisons: *with Sham; #with Cerebral Ischemic Reperfusion

Click here to view


Eriocitrin decreased the cerebral ischemic reperfusion injury induced elevation in inflammatory markers in brain cells of mice

The experimental animals which are subjected to cerebral ischemia were indicated the rapidly elevated status of inflammatory mediators that is TNF-α, IL-6, and IL-1β in the brain tissues of CIRI animals than the sham animals. In this test, it was proven that eriocitrin (100 mg/kg) treatment distressingly decreased the inflammatory mediator's status in the brain tissues, which was elevated by cerebral ischemia [Figure 3], [Figure 4], [Figure 5]. Thus, Eriocitrin can lessen the elevated inflammatory cytokines status in the brain tissues at cerebral ischemic conditions and highlighting the therapeutic value of Eriocitrin against CIRI.
Figure 3: Levels of inflammatory cytokine tumor necrosis factor α on Cerebral Ischemic Reperfusion Injury and treatment by Eriocitrin in experimental mice. Data were presented as mean ± standard devitation. A P ≤ 0.05 was considered statistically significant. Comparisons: *with Sham; #with Cerebral Ischemic Reperfusion

Click here to view
Figure 4: Levels of inflammatory cytokine interleukin-1β on Cerebral Ischemic Reperfusion Injury and treatment by Eriocitrin in experimental mice. Data were presented as mean ± standard deviation. A P ≤ 0.05 was considered statistically significant. Comparisons: *with Sham; #with Cerebral Ischemic Reperfusion

Click here to view
Figure 5: Levels of inflammatory cytokine interleukin-6 on Cerebral Ischemic Reperfusion Injury and treatment by Eriocitrin in experimental mice. Data were presented as mean ± standard decitation. A P ≤ 0.05 was considered statistically significant. Comparisons: *with Sham; #with Cerebral Ischemic Reperfusion

Click here to view


Eriocitrin ameliorates the apoptotic protein expressions in the brain tissues of cerebral ischemic reperfusion injury mice model

The expression status of the apoptotic proteins that are NFƙB, caspase-3, and caspase-9 was examined through the western blotting method and the result is depicted in [Figure 6]. The expression status of NFƙB, caspase-3 and caspase-9 proteins, which were related with the apoptotic pathway was severely uplifted during the cerebral ischemia in mice while comparing to the sham subjected group. The Eriocitrin (100 mg/kg) treatment revealed the striking reduction in the expression apoptotic markers i.e., phosphorylated NFƙB as well as caspase-3 and caspase-9. The result of assessment was evidenced that the Eriocitrin exhibited a drastic reduction in the apoptotic marker's expression in the brain tissues of cerebral ischemic mice replica, which representing the therapeutic importance of Eriocitrin.
Figure 6: (a-c). Western blot analyses of apoptotic proteins in Cerebral Ischemic Reperfusion injury and Eriocitrintreatment in experimental mice. Data were presented as mean ± standard decitation. A P ≤ 0.05 was considered statistically significant. Comparisons: *with Sham; #with Cerebral Ischemic Reperfusion

Click here to view


Eriocitrin prevented the brain tissues in the experimental mice model

[Figure 7] exemplifies the cyto-architecture of the brain tissues of experimental animals. The H and E stained brain tissues demonstrated that there were severe changes in the tissue architecture and the loss of neuronal cells in the CIRI operated animals when compared to control. However, the eriocitrin treated animals exhibited almost normal histological structures in the brain tissues. The eriocitrin treatment also improved the viable neuronal cell population in the experimental animals.
Figure 7: Histopathological analysis of Cerebral Ischemic Reperfusion Injury and Eriocitrin treatment in experimental mice

Click here to view



   Discussion Top


The CIRI is a harsh ailing condition of the brain, which often results in severe neural afflictions and irretrievable neural necrosis. CIRI occupied in many crucial pathological processes for instance, oxidative stress, excessive intracellular calcium load, inflammatory damages, mitochondrial damage, apoptosis and acidosis, and so it is essential to find an enhanced neuroprotective agent against the CIRI.[28],[29],[30] The ischemic stroke takes place at any time if there is a perpetual occlusion in the blood vessels, which delivers blood to the brain tissues that ultimately result in necrosis of neural cells.[1] Though the supplying of blood to whole parts of the body is mandatory, in particular, the brain is thought to more vulnerable to the occlusion of arteries due to the highest metabolic pace and more oxygen demands.[31]

Also, the brain is a first-ever organ that suffers from the declined blood supply and denied sufficient oxygen level that finally results in neural tissue necrosis. The mechanisms of brain tissues were blocked abruptly after irretrievable injuries at the time of poor oxygen delivery due to the suspended blood circulation rate. Accordingly, the functions of brain tissues depending on effective enough blood deliver to the brain cells.[31],[32] The harsh injuries to the cortex of the cerebrum, cerebellum and the ganglia through ischemic stroke was thought to encourage the prevalent neuronal defects and long-lasting disabilities which frequently illustrious the ailment due to lessen blood deliver to brain.[33],[34] The nitric oxide is an imperative one which contributes vital molecules for the controlling of blood supply to cerebrum.[35] In this investigation, the RT-PCR result displayed a severe elevation in the expression of mRNA of nNOS which denotes the cerebral ischemic-reperfusion condition, enchantingly the Eriocitrin treatment declined the unkindly elevated expression status of nNOS in CIRI mice replica [Figure 2].

Though a pathological mechanism of CIRI was regarded as exceeding inflammatory reactions, as well, neural apoptosis, which is mediated through an array of genes was too anticipated to take an essential function on the mutilation of neural mechanisms. Thus, the maintenance of the internal permanence of body organs especially a brain was obligatory.[36] Copious research statements displayed that ischemic-reperfusion damage is a crucial stimulus that can stimulate the expressions of apoptotic genes thereby results in neural apoptosis.[37],[38] Caspase-3 is an important protease to breakdown the cytoskeleton and nucleus proteins. It is the most effectual apoptotic regulator in a category of caspase proteins. The expression status of caspase-3 is often marked as a characteristic of apoptosis.[39] In this exploration, the CIRI subjected animals showed the uplifted level of caspase-3 expression, while eriocitrin treatment markedly reduced the expression status of caspase-3 [Figure 6]c.

Besides, inflammation is an essential route which can direct toward the apoptosis in neural cells. The NFƙB is an essential transcriptional factor of inflammation and it can get triggered quickly on the acute cerebral ischemic condition, which highlights the uplifted expression status of NFƙB in the cerebral ischemic mice of investigation.[40],[41],[42] The NFƙB signalling pathway is engaged in acute cerebral ischemic condition since it directs to the accretion of inflammatory regulators including TNF-α, IL-1β, and IL-6 and thereby after further damages. It is highlighted that the despite transient cerebral ischemic replica, the agent which can inoperative the NFƙB can markedly reduce the volume of infarction and enhancing the neural defects which highlighting that the aiming the NFƙB pathway afterward to cerebral ischemia-reperfusion may be a hopeful healing approach.[43]

The stimulation of the NFƙB signalling pathway in neural cells can radically elevate the transcription of inflammatory genes thereby decodes the inflammatory regulators i.e., TNF-α, IL-1 β and IL-6.[44],[45] The NFƙB is considered the stress-mediated transcriptional modulator that takes a crucial function in the controlling of inflammatory reactions. NFƙB signalling cascade is anticipated to take part in essential inflammatory functions in the damages of the CNS, which includes the traumatic brain damage, permanent focal ischemia and ischemic reperfusion.[46] It has already been reported that the NFƙB regulated apoptosis and inflammatory signalling pathways were taking a crucial function in the pathological process of CIRI, thereby it activates the microglia after cerebral ischemia and enhancing the post-ischemic inflammatory processes.[47],[48]

The TNF-α was illustrious as the highly reactive cytokine and it can be viewed as an imperative proinflammatory regulator along with double functions in the NFƙB signalling pathway. In many cases, the IL-1β status was raised drastically after the many inflammatory reactions and contributing to the pathological processes of inflammation.[49] In the ischemic stroke victims, the IL-6 was associated with the deterioration of neurons, increasing infarction levels and deprived long-lasting effects.[50] The highest level of TNF-α in the plasma was as well linked to the volume of infarction and deficits of neurons on the several studied models of ischemic stroke.[41] Besides, at some stages in reperfusion, the elevated level of steroids in serum could worsen the neural damages via perturbing the glucose homeostasis and uplifting the oxidative stress in the brain.[51]

As a result, the amelioration of inflammatory conditions after cerebral ischemic damage will contribute in a defensive function in the treatment of cerebral ischemia. In this investigation, the signalling cascade NFƙB was uplifted drastically [Figure 6]a and [Figure 6]b and the grades of TNF-α, IL-1β and IL-6 were as well elevated severely [Figure 3], [Figure 4], [Figure 5] in the CIRI subjected animals. Surprisingly, the Eriocitrin treatment ameliorated the too much expressions of apoptotic proteins that is (p) NFƙB, caspase-3 and caspase-9 in the cerebral ischemic-reperfusion animals, in that way, the Eriocitrin treatment was as well distressingly attenuated the drastic elevation in inflammatory markers, for instance TNF-α, IL-1β and IL-6 in the CIRI animals, which decoding the therapeutic value of Eriocitrin towards the neuroprotection in CIRI condition through lessening the inflammatory response subsequent to cerebral ischemic condition.

Besides, Wang et al.[52] defined that the neuroprotectants was appreciably declined the expression patterns of NF-κB, which signifies the NF-κB was substantially playing an indispensable function in the pathological process of ischemic brain injury in animal test, which highlighting the inflammatory signs regulated through NF-κB was an essential to the ischemic stroke progression.[53] In agreement with this finding, this current investigation was showed that the Eriocitrin was extraordinarily weakened to the cerebral ischemic damage in the mice.


   Conclusion Top


The novel findings of this exploration disclosed the astounding neuro-protection value of Eriocitrin in opposition to CIRI, which is provoked through the carotid arterial occlusion in mice replica via assuaging the elevated expressions of apoptotic proteins and inflammatory regulators. It was concluded that the Eriocitrin, a flavonoid compound of Citrus limon can be a promising neuroprotectant for the treatment of cerebral ischemia.

Acknowledgements

The authors would like to thank the 910th Hospital of the Joint Logistics Support Force of the Chinese People's Liberation Army, Quanzhou, 362000, P. R. China.

Financial support and sponsorship

Shanghai Putuo District clinical characteristic construction project (No: 2019tszk01), Shanghai Association of the Integration of Traditional and Western Medicine (No: SH201741). Independent Innovation of Health System Research (No: ptkwws201708).

Conflicts of interest

There are no conflicts of interest.



 
   References Top

1.
Smith G. Acute stroke-diagnosis and management, Scott Univ Med J 2014;3:18-27.  Back to cited text no. 1
    
2.
Macrez R, Ali C, Toutirais O, Le Mauff B, Defer G, Dirnagl U, et al. Stroke and the immune system: From pathophysiology to new therapeutic strategies. Lancet Neurol 2011;10:471-80.  Back to cited text no. 2
    
3.
Feigin VL, Krishnamurthi RV, Parmar P, Norrving B, Mensah GA, Bennett DA, et al. GBD 2013 Stroke Panel Experts Group, Update on the global burden of ischemic and hemorrhagic stroke in 1990-2013: The GBD2013 study, Neuroepidemiology 2015;45:161-76.  Back to cited text no. 3
    
4.
Anrather J, Iadecola C. Inflammation and stroke: An overview. Neurotherapeutics 2016;13:661-70.  Back to cited text no. 4
    
5.
Mazzucco S, Diomedi M, Qureshi A, Sainati L, Padayachee ST, Transcranial Doppler screening for stroke risk in children with sickle cell disease: A systematic review. Int J Stroke 1747493017706189official journal of the International Stroke Society. 2017.  Back to cited text no. 5
    
6.
Shankaran S. Hypoxic-ischemic encephalopathy and novel strategies for neuroprotection. Clin Perinatol 2012;39:919-29.  Back to cited text no. 6
    
7.
Sanches EF, van de Looij Y, Toulotte A, Sizonenko SV, Lei H. Mild neonatal brain hypoxia-ischemia in very immature rats causes long-term behavioral and cerebellar abnormalities at adulthood. Front Physiol 2019;10:634.  Back to cited text no. 7
    
8.
Bhalala US, Koehler RC, Kannan S. Neuroinflammation and neuroimmune dysregulation after acute hypoxic-ischemic injury of developing brain. Front Pediatr 2014;2:144.  Back to cited text no. 8
    
9.
Hagberg H, Mallard C, Ferriero DM, Vannucci SJ, Levison SW, Vexler ZS, et al. The role of inflammation in perinatal brain injury. Nat Rev Neurol 2015;11:192-208.  Back to cited text no. 9
    
10.
Shen H, Hu X, Liu C, Wang S, Zhang W, Gao H, et al. Ethyl pyruvate protects against hypoxic-ischemic brain injury via anti-cell death and anti-inflammatory mechanisms. Neurobiol Dis 2010;37:711-22.  Back to cited text no. 10
    
11.
Tang M, Alexander H, Clark RS, Kochanek PM, Kagan VE, Bayir H. Minocycline reduces neuronal death and attenuates microglial response after pediatric asphyxial cardiac arrest, J. Cereb. Blood Flow Metab. Off. J. Int. Soc. Cereb. Blood Flow and Metab. 2010;30:119-29.  Back to cited text no. 11
    
12.
Chapman SN, Mehndiratta P, Johansen MC, McMurry TL, Johnston KC, Southerland AM. Current perspectives on the use of intravenous recombinant tissue plasminogen activator (tPA) for treatment of acute ischemic stroke. Vasc Health Risk Manag 2014;10:75-87.  Back to cited text no. 12
    
13.
del Zoppo GJ. Acute anti-inflammatory approaches to ischemic stroke. Ann N Y Acad Sci 2010;1207:143-8.  Back to cited text no. 13
    
14.
Hua F, Tang H, Wang J, Prunty MC, Hua X, Sayeed I, et al. TAK-242, an antagonist for Toll-like receptor 4, protects against acute cerebral ischemia/reperfusion injury in mice. J Cereb Blood Flow Metab 2015;35:536-42.  Back to cited text no. 14
    
15.
Orsu P, Murthy BV, Akula A. Cerebroprotective potential of resveratrol through anti-oxidant and anti-inflammatory mechanisms in mice. J Neural Transm 2013;120:1217-23.  Back to cited text no. 15
    
16.
Crack PJ, Taylor JM. Reactive oxygen species and the modulation of stroke. Free Radic Biol Med 2005;38:1433-44.  Back to cited text no. 16
    
17.
Gob E, Reymann S, Langhauser F, Schuhmann MK, Kraft P, Thielmann I, et al. Blocking of plasma kallikrein ameliorates stroke by reducing thrombo inflammation. Neurology. 2015;77:784-803.  Back to cited text no. 17
    
18.
Hillis AE, Rorden C, Fridriksson J. Brain regions essential for word comprehension: Drawing inferences from patients. Ann Neurol 2017;81:759-68.  Back to cited text no. 18
    
19.
Tu XK, Yang WZ, Shi SS, Wang CH, Zhang GL, Ni TR, et al. Spatio-temporal distribution of inflammatory reaction and expression of TLR2/4 signaling pathway in rat brain following permanent focal cerebral ischemia. Neurochem Res 2010;35:1147-55.  Back to cited text no. 19
    
20.
Tu XK, Yang WZ, Chen JP, Chen Y, Ouyang LQ, Xu YC, et al. Curcumin inhibits TLR2/4-NF-kB signaling pathway and attenuates brain damage in permanent focal cerebral ischemia in rats. Inflammation 2014;37:1544-51.  Back to cited text no. 20
    
21.
Barakat W, Safwet N, El-Maraghy NN, Zakaria MN. Candesartan and glycyrrhizin ameliorate ischemic brain damage through downregulation of the TLR signaling cascade. Eur J Pharmacol 2014;724:43-50.  Back to cited text no. 21
    
22.
Hwang SL, Shih PH, Yen GC. Neuroprotective effects of citrus flavonoids. J Agric Food Chem 2012;60:877-85.  Back to cited text no. 22
    
23.
Ho SC, Kuo CT. Hesperidin, nobiletin, and tangeretin are collectively responsible for the anti-neuroinflammatory capacity of tangerine peel (Citrireticulataepericarpium). Food Chem Toxicol 2014;71:176-82.  Back to cited text no. 23
    
24.
Ferreira PS, Spolidorio LC, Manthey JA, Cesar TB. Citrus flavanones prevent systemic inflammation and ameliorate oxidative stress in C57BL/6J mice fed high-fat diet. Food Funct 2016;7:2675-81.  Back to cited text no. 24
    
25.
Hiramitsu M, Shimada Y, Kuroyanagi J, Inoue T, Katagiri T, Zang L, et al. Eriocitrin ameliorates diet-induced hepatic steatosis with activation of mitochondrial biogenesis. Sci Rep 2014;4:3708.  Back to cited text no. 25
    
26.
Ni J, Wang X, Chen S, Liu H, Wang Y, Xu X, et al. MicroRNA let-7c-5p protects against cerebral ischemia injury via mechanisms involving the inhibition of microglia activation. Brain Behav Immun 2015;49:75-85.  Back to cited text no. 26
    
27.
Zhou YH, Liu D. Effect of Kudiezi injection on serum inflammatory factors, curative effect and quality of life of acute cerebral infarction. Chin Arch Tradit Chin Med 2016;34:900-3.  Back to cited text no. 27
    
28.
Catanese L, Tarsia J, Fisher M. Acute ischemic stroke therapy overview. Circ Res 2017;120:541-58.  Back to cited text no. 28
    
29.
Chamorro Á, Dirnagl U, Urra X, Planas AM. Neuroprotection in acute stroke: Targeting excitotoxicity, oxidative and nitrosative stress, and inflammation. Lancet Neurol 2016;15:869-81.  Back to cited text no. 29
    
30.
Sommer CJ. Ischemic stroke: experimental models and reality. Acta Neuropathol 2017;133:245-61.  Back to cited text no. 30
    
31.
Millar LJ, Shi L, Hoerder-Suabedissen A, Molnár Z. Neonatal hypoxia ischaemia: Mechanisms, models, and therapeutic challenges. Front Cell Neurosci 2017;11:78.  Back to cited text no. 31
    
32.
Meng H, Zhao H, Cao X, Hao J, Zhang H, Liu Y, et al. Double-negative T cells remarkably promote neuroinflammation after ischemic stroke. Proc Natl Acad Sci U S A 2019;116:5558-63.  Back to cited text no. 32
    
33.
Parada E, Casas AI, Palomino-Antolin A, Gómez-Rangel V, Rubio-Navarro A, Farré-Alins V, et al. Early toll-like receptor 4 blockade reduces ROS and inflammation triggered by microglial pro-inflammatory phenotype in rodent and human brain ischaemia models. Br J Pharmacol 2019;176:2764-79.  Back to cited text no. 33
    
34.
Ramsey LE, Siegel JS, Lang CE, Strube M, Shulman GL, Corbetta M. Behavioural clusters and predictors of performance during recovery from stroke. Nat Hum Behav 2017;1:0038. doi: 10.1038/s41562-016-0038. Epub 2017 Feb 17.  Back to cited text no. 34
    
35.
Garry PS, Ezra M, Rowland MJ, Westbrook J, Pattinson KT. The role of the 48 nitric oxide pathway in brain injury and its treatment – From bench to 49 bedside. Exp Neurol 2015;263:235-43.  Back to cited text no. 35
    
36.
Fricker M, Tolkovsky AM, Borutaite V, Coleman M, Brown GC. Neuronal cell Death. Physiol Rev 2018;98:813-80.  Back to cited text no. 36
    
37.
Rodriguez J, Zhang Y, Li T, Xie C, Sun Y, Xu Y, et al. Lack of the brain-specific isoform of apoptosis-inducing factor aggravates cerebral damage in a model of neonatal hypoxia-ischemia. Cell Death Dis 2018;10:3.  Back to cited text no. 37
    
38.
Liu J, An P, Xue Y, Che D, Liu X, Zheng J, et al. Mechanism of Snhg8/miR-384/Hoxa13/FAM3A axis regulating neuronal apoptosis in ischemic mice model. Cell Death Dis 2019;10:441.  Back to cited text no. 38
    
39.
Shen X, Venero JL, Joseph B, Burguillos MA. Caspases orchestrate microglia instrumental functions. Prog Neurobiol 2018;171:50-71.  Back to cited text no. 39
    
40.
Chen FQ, Li Q, Pan CS, Liu YY, Yan L, Sun K, et al. Kudiezi injection (R) alleviates blood-brain barrier disruption after ischemia-reperfusion in rats. Microcirculation 2016;23:426-37.  Back to cited text no. 40
    
41.
Petrovic-Djergovic D, Goonewardena SN, Pinsky DJ. Inflammatory disequilibrium in stroke. Circ Res 2016;119:142-58.  Back to cited text no. 41
    
42.
Jayaraj RL, Azimullah S, Beiram R, Jalal FY, Rosenberg GA. Neuroinflammation: Friend and foe for ischemic stroke. J Neuroinflammation 2019;16:142.  Back to cited text no. 42
    
43.
Liu X, Tao Y, Wang F, Yao T, Fu C, Zheng H, et al. Kudiezi injection mitigates myocardial injury induced by acute cerebral ischemia in rats. BMC Complement Altern Med 2017;17:8.  Back to cited text no. 43
    
44.
Nurmi A, Lindsberg PJ, Koistinaho M, Zhang W, Juettler E, Karjalainen-Lindsberg ML, et al. Nuclear factor-kappaB contributes to infarction after permanent focal ischemia. Stroke 2004;35:987-91.  Back to cited text no. 44
    
45.
Chen L, Kong L, Wei X, Wang Y, Wang B, Zhang X, et al. β-arrestin 2 negatively regulates NOD2 signalling pathway through association with TRAF6 in microglia after cerebral ischaemia/reperfusion injury. J Cell Mol Med 2019;23:3325-5.  Back to cited text no. 45
    
46.
Jin Z, Liang J, Wang J, Kolattukudy PE. MCP-induced protein1 mediates the minocycline-induced neuroprotection against cerebral ischemia/reperfusion injury in vitro and in vivo. J Neuroinflamm 2015;12:39.  Back to cited text no. 46
    
47.
Cao Q, Li P, Lu J, Dheen ST, Kaur C, Ling EA. Nuclear factor-κB/p65 responds to changes in the Notch signaling pathway in murine BV-2 cells and in amoeboid microglia in postnatal rats treated with the γ-secretase complex blocker DAPT. J Neurosci Res 2010;88:2701-14.  Back to cited text no. 47
    
48.
Cao Q, Kaur C, Wu CY, Lu J, Ling EA. Nuclear factor-kappa β regulates Notch signaling in production of proinflammatory cytokines and nitric oxide in murine BV-2 microglial cells. Neuroscience 2011;192:140-54.  Back to cited text no. 48
    
49.
Li XQ, Wang J, Fang B, Tan WF, Ma H. Intrathecal antagonism of microglial TLR4 reduces inflammatory damage to blood–spinal cord barrier following ischemia/reperfusion injury in rats. Mol Brain 2014;7:28.  Back to cited text no. 49
    
50.
Vila N, Castillo J, Dávalos A, Chamorro A. Proinflammatory cytokines and early neurological worsening in ischemic stroke. Stroke 2000;31:2325-9.  Back to cited text no. 50
    
51.
Manzanero S, Santro T, Arumugam TV. Neuronal oxidative stress in acute ischemic stroke: Sources and contribution to cell injury. Neurochem Int 2013;62:712-8.  Back to cited text no. 51
    
52.
Wang X, Hu D, Zhang L, Lian G, Zhao S, Wang C, et al. Gomisin A inhibits lipopolysaccharide-induced inflammatory responses in N9 microglia via blocking the NF-κB/MAPKs pathway. Food Chem Toxicol 2014;63:119-27.  Back to cited text no. 52
    
53.
Belinga VF, Wu GJ, Yan FL, Limbenga EA. Splenectomy following MCAO inhibits the TLR4-NF-κB signaling pathway and protects the brain from neurodegeneration in rats. J Neuroimmunol 2016;293:105-13.  Back to cited text no. 53
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7]



 

Top
   
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Introduction
    Materials and Me...
   Results
   Discussion
   Conclusion
    References
    Article Figures

 Article Access Statistics
    Viewed112    
    Printed0    
    Emailed0    
    PDF Downloaded23    
    Comments [Add]    

Recommend this journal