Home | About PM | Editorial board | Search | Ahead of print | Current Issue | Archives | Instructions | Subscribe | Advertise | Contact us |  Login 
Pharmacognosy Magazine
Search Article 
  
Advanced search 
 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 16  |  Issue : 67  |  Page : 34-42  

Enhancing glucose uptake by Astraeus odoratus and Astraeus asiaticus extracts in L6 myotubes


1 Division of Pharmacognosy and Toxicology, Faculty of Pharmaceutical Sciences, Khon Kaen University, Khon Kaen, Thailand
2 Department of Biochemistry, Faculty of Sciences, Khon Kaen University, Khon Kaen, Thailand
3 Department of Thai Traditional Medicine, Faculty of Health and Sport Sciences, Thaksin University, Phatthalung, Thailand

Date of Submission25-Jul-2019
Date of Decision09-Aug-2019
Date of Web Publication11-Feb-2020

Correspondence Address:
Natsajee Nualkaew
Division of Pharmacognosy and Toxicology, Faculty of Pharmaceutical Sciences, Khon Kaen University, Khon Kaen 40002
Thailand
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/pm.pm_323_19

Rights and Permissions
   Abstract 


Background: Mushrooms, including Astraeus spp., are known for hypoglycemic properties. Astraeus odoratus is a delicious edible mushroom, while Astraeus asiaticus is less popular due to its unpleasant texture. Both mushrooms have not been reported for the glucose uptake activities yet. Objectives: The aim of this study is to describe the enhancing of glucose uptake and related mechanisms in vitro of the extracts from two Astraeus spp. Materials and Methods: The extracts of A. odoratus and A. asiaticus (AO and AA, respectively) were assayed for the stimulation of glucose uptake in L6 myotubes. The mechanism of actions was proved by using specific inhibitors and determined for the expression of glucose transporters type 1 and 4 (GLUT1 and GLUT4) by quantitative real-time polymerase chain reaction and Western blotting. Results: The extracts of both mushrooms enhanced glucose uptake in the muscle cells L6 myotubes at the level of the function of GLUT1 and GLUT4, which involved the partial stimulation of their intrinsic activities through p38 mitogen-activated protein kinase and increased GLUT1 and GLUT4 protein levels. AO increased both GLUT1 and GLUT4 protein, while AA increased mainly GLUT4 protein and stimulated GLUT4 translocation through phosphatidylinositol 3-kinase. Conclusion: The results supported the hypoglycemic activity of A. odoratus and A. asiaticus and suggested their potential use for hypoglycemic purposes.

Keywords: Astraeus asiaticus, Astraeus odoratus, glucose uptake, hypoglycemic mushroom, L6 myotubes


How to cite this article:
Phadannok P, Naladta A, Noipha K, Nualkaew N. Enhancing glucose uptake by Astraeus odoratus and Astraeus asiaticus extracts in L6 myotubes. Phcog Mag 2020;16:34-42

How to cite this URL:
Phadannok P, Naladta A, Noipha K, Nualkaew N. Enhancing glucose uptake by Astraeus odoratus and Astraeus asiaticus extracts in L6 myotubes. Phcog Mag [serial online] 2020 [cited 2020 Feb 24];16:34-42. Available from: http://www.phcog.com/text.asp?2020/16/67/34/278014



SUMMARY

  • Astraeus odoratus and A. asiaticus were potential sources for hypoglycemic purposes
  • Astraeus odoratus extract (AO) and A. asiaticus extract (AA) enhanced glucose uptake through insulin dependent pathway which involved the function of glucose transport protein intrinsic activities via p38 mitogen-activated protein kinase
  • AO increased both glucose transporters type 1 and glucose transporters type 4 (GLUT4) proteins, while AA affected phosphatidylinositol 3-kinase and increased mainly GLUT4 protein.




Abbreviations used: GLUT1: Glucose transporter protein type 1; GLUT4: glucose transporter protein type 4; AO: Hexane layer from ethanolic extract of Astraeus odoratus; AA: Hexane layer from ethanolic extract of Astraeus asiaticus; P38 MAPK: P38 mitogen-activated protein kinase; PI-3K: Phosphatidylinositol 3-kinase


   Introduction Top


Diabetes mellitus is a chronic metabolic disease caused by hyperglycemia from insulin insufficiency and/or insulin resistance (insulin insensitivity). This condition leads to a high risk of cardiovascular diseases, kidney dysfunction, blindness, and other diseases. Diabetes medicines used to control blood glucose level include insulin releasers, insulin sensitizers, and alpha-glucosidase inhibitors. However, these medicines have mild-to-severe side effects such as hypoglycemia, lactic acidosis, and increased cardiovascular disease risk.[1] On the other hand, prediabetic conditions, in which the blood sugar level is not high enough to be classified as diabetes are a high risk of type 2 diabetes. In this situation, it is still possible to prevent or delay the development to diabetes by exercise, diet, functional foods, and the use of antidiabetic drugs.[2],[3] The consumption of herbs that regulate blood sugar levels has also become an option to prevent the progress of the prediabetic condition to diabetes.

Mushrooms are not only good sources of nutrients but also potential sources for health products due to their pharmacological activities in preventing diseases such as diabetes, hypercholesterolemia, cancer, and hypertension. Mushrooms with hypoglycemic activity include Ganoderma lucidum,[4]Lentinus edodes,[5] and Astraeus hygrometricus.[6] The bioactive compounds of mushrooms that reduce blood glucose level are mainly polysaccharides such as beta-glucan and glucuronoxylomannan.[7],[8] Triterpenoids from mushrooms are also reported to have hypoglycemic activity such as dehydrotrametenolic acid from Poria cocos[9] and ergosterol.[10] Although hypoglycemic herbs and mushrooms have been used as diabetic functional foods worldwide, there is still a need for the demonstration of efficacy and mechanism of action.

Astraeus is a mushroom of the family Diplocystaceae. There are approximately 10 species described and used for cooking in many countries, including India, Japan, Laos, and Thailand.[11] In Thailand, Astraeus odoratus Phosri, Watling, M.P. Martín & Whalley is an edible mushroom that is a favorite of Thai people, whereas Astraeus asiaticus Phosri, M.P. Martín & Watling, is also edible but has an unpleasant texture and has been discarded. Both Astraeus species are generally found in the northern and northeastern regions of Thailand [12] and contain triterpenoids as the main chemical components.[13],[14],[15],[16],[17] To date, although there have been no reports of antidiabetic biological activities for of both mushrooms, the presence of many triterpenoids, including the bioactive compound ergosterol in Astraeus, brought researchers attention to investigate for their hypoglycemic activities.

Glucose uptake is an important process to decrease blood glucose in skeletal muscle, adipocytes, and liver. Uptake is stimulated by insulin in insulin-sensitive tissue such as muscle cells and by insulin-independent mechanisms in vital organs such as the brain and red blood cells. As the muscle cell is the major target for glucose uptake, rat L6 myotubes were used for activity assays of the extracts from both Astraeus mushrooms in this study. Enhancing glucose uptake in muscle cells involves glucose transporters type 1 and 4 (GLUT1 and GLUT4) with regard to the translocation (for GLUT4), the intrinsic activity and affinity to glucose,[18] and the increase in GLUTs levels. GLUT1 is located at the cell surface, while GLUT4 is distributed in the cytosol. Insulin causes GLUT4 to undergo translocation from the cytosol to the plasma membrane for collecting glucose and results in a lower blood glucose level.[19] GLUT4 translocation is inhibited by the phosphatidylinositol 3-kinase (PI-3K) inhibitor wortmannin while the intrinsic activity of GLUT4 is inhibited by the p38 mitogen-activated protein kinase (p38 MAPK) inhibitor SB203580. The synthesis of proteins responsible for the glucose uptake process could be proved by using the protein synthesis inhibitor cycloheximide.

To date, numerous mushrooms have not been studied for their hypoglycemic effect. Although mushrooms are potential sources of anti-diabetic compounds,[20] the market for mushroom-based hypoglycemic products remains restricted to a few mushrooms, such as Agaricus blazei and Grifola frondosa.[21] Since the activity and mechanism related to the insulin signaling pathway of Astraeus spp. have not been described and Astraeus mushrooms were proposed to possess hypoglycemic activities, this study is the first to assess in vitro glucose uptake activities and mechanisms of A. odoratus and A. asiaticus in L6 myotubes. These findings could suggest their potential use as new sources of hypoglycemic products for diabetes prevention and lead to added value for the distasteful A. asiaticus.


   Materials and Methods Top


Chemicals and reagents

All general solvents and chemicals were analytical grade. Ergosterol (purity >98%) was purchased from Biopurity, China. Alpha-minimum essential medium (α-MEM), fetal bovine serum (FBS), 0.25% trypsin-EDTA, horse serum (HS), penicillin-streptomycin, and trypan blue were obtained from GibCo, USA. Human insulin solution was purchased from Santa Cruz, USA. The glucose (GO) assay kit, wortmannin, cycloheximide, cytochalasin B, and SB203580 were purchased from Sigma-Aldrich, USA. The Superscript III first-strand synthesis system for reverse transcription-polymerase chain reaction (PCR), 1 Kb plus DNA ladder, 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and Trizol reagent were obtained from Invitrogen, USA. Prestained protein marker and SsoAdvanced Universal: SYBR Green Supermix was purchased from Bio-Rad, USA. Anti-GLUT1 antibody and anti-GLUT4 antibody were obtained from Millipore, Germany. Anti-actin antibody anti-rabbit IgG horseradish peroxidase (HRP)-linked antibody, anti-mouse IgG HRP-linked antibody, and enhanced chemiluminescent (ECL) Western blotting substrate kit were purchased from GE Healthcare, USA. RIPA buffer was from Thermo Scientific, USA.

Astraeus materials

A. odoratus was purchased from a local market in Khon Kaen province and A. asiaticus was purchased from a local market in Mahasarakham province, Thailand. They were macroscopically differentiated and were confirmed by comparing the physical appearance and microscopy of spores to the literature.[12],[22] The spores were stained using Melzer's reagent [23] and investigated by light microscopy.

Preparation of Astraeus odoratus and Astraeus asiaticus extracts

The mushrooms were washed, dried at 50°C, and ground. Dried powders were macerated three times with 95% EtOH. The extracts were dried using a rotary evaporator and freeze-dried. They were then kept at −20°C until use.

The ethanolic extract was suspended in water and centrifuged. The pellet was freeze-dried and then was partitioned between 2% aqueous MeOH and hexane. The hexane layer was dried using a rotary evaporator and freeze-dried to obtain the hexane fractions which were used in this study. Those fractions from A. odoratus and A. asiaticus were named AO and AA, respectively.

Thin-layer chromatography of Astraeus extracts

Thin-layer chromatography (TLC) of both Astraeus was performed using silica gel GF254 precoated plates (Merck, Germany), a mobile phase of hexane-EtOAc (8.5:1.5), visualization under UV 254 nm and spraying with 10% H2 SO4. Ergosterol was used as a biomarker.

High-performance liquid chromatography of Astraeus extracts

High-performance liquid chromatography (HPLC) pattern of Astraeus extracts (1 mg/mL) was determined on an Agilent 1220 series HPLC (Agilent Technologies). The separation was carried out on a VertiSep C30 column (4.8 mm × 250 mm, 5 μm, Vertical Chromatography, Thailand). A solvent system consisted of H2O (solvent A) and MeOH (solvent B) with a gradient elution as followed: 0–5 min, 0%B; 15 min, 80%B; 35 min, 100%B; and 35–70 min, 100%B. The flow rate was 1.0 mL/min, and the injection volume was 20 μL. The UV detector was used at 280 nm.

Cell cultures

L6 myoblast (American Type Culture Collection [ATCC], CRL-1458) was purchased from ATCC, USA. Cells, 3 × 105 cells, were grown in 100 mm x 20 mm cell culture dish containing α-MEM, 10% FBS and 1% penicillin-streptomycin at 37°C with 5% CO2 and were subcultured into 24-well plates (0.1 × 105 cells/well). After reaching 70%–80% confluence, cells were differentiated by replacing 10% FBS in the culture media with 2% HS. The medium was changed every 48 h until 80%–90% myotubes were obtained.

Cell viability assay (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay)

Cell viability was assessed using the MTT assay [24] to obtain the optimal concentration of extracts that provided cell viabilities not <80% of basal levels (untreated control). L6 myotubes were treated with extracts at various concentrations for 48–50 h at 37°C, 5% CO2. Then, the media were discarded and the cells were incubated with 0.5 mg/mL MTT for 2 h. After washing the cells with PBS, the formazan crystals were dissolved in 500 μL dimethylsulfoxide and absorbance measured at 570 nm. The percentage cell viability was calculated as follows:

Percentage cell viability = (Asample/Abasal) × 100

where Abasal was the absorbance of the untreated cells and Asample was the absorbance of the treated cells.

Glucose uptake assay in L6 myotubes

Extracts (400 μL) in α-MEM containing 2% HS were used to treat L6 myotubes in 24 well plates for 50 h at 37°C and 5% CO2. The culture media were collected, and the glucose content was determined using a glucose assay kit according to the manufacturer's protocol. The glucose content was calculated from a glucose standard graph. The percentage of decreasing media glucose from that of basal levels at 50-h incubation time was considered as percentage stimulation of glucose uptake, calculated as follows:

Percentage stimulation of glucose uptake = ([glucosebasal-glucosesample] × 100)/glucosebasal

where glucosebasal was the glucose content of the basal media and glucosesample was the glucose content in the media of treated samples.

EC50 was the concentration of extracts or insulin that provided a reduction in medium glucose by 50% from that of basal levels at 50 h, indicating 50% stimulation of glucose uptake to L6 myotubes. A treatment of 25-50 nM insulin was used as a positive control, and the basal level was used as a negative control.

Effect of inhibitors on the glucose uptake activities of the extracts

To study the mechanism of action of the glucose uptake activity by AO and AA in L6 myotubes, the inhibitors were added to the treated samples as follows: 3 μM wortmannin was added after cells had been incubated with extracts for 1 h; 2 μM cytochalasin B and 20 μM SB203580 were added after cells had been incubated with the extracts for 4 h; and 3.5 μM cycloheximide was added together with the extracts.

Quantitative real-time polymerase chain reaction

The 10 μL quantitative real-time PCR (qPCR) reaction consisted of cDNA equivalent to 12 ng of total RNA, SsoAdvanced Universal: SYBR Green Supermix and 0.2 μM of the forward and reverse primers. The primers were: GADPH forward: 5′ GAAGGTCGGTGTGAACGGAT 3′; GADPH reverse: 5′ ACCAGCTTCCCATTCTCAGC 3´; GLUT1 forward: 5´ ATAGGGGTCCAGGCTCCATT 3′; GLUT1 reverse: 5′ GAGTGTCCGTGTCTTCAGCA 3′; GLUT4 forward: 5′ GGTTGTCTTGACCCCTCCAG 3′; and GLUT4 reverse: 5′ TTCGGGTTTAGCACCCTTCC 3′. The qPCR was run in a real time PCR machine (CFX96 Touch Real-Time PCR, Bio-Rad, USA). The PCR cycle was predenaturation at 95°C for 3 min followed by 40 cycles of 95°C for 20 s, 57°C for 20 s and 72°C for 30 s. The melting curve analysis was 95°C for 5 s, 65°C for 5 s, and 95°C for 5 s to verify the amplification product. Negative controls consisted of the reaction mixture with water instead of cDNA. The housekeeping gene glyceraldehyde-3-phosphate dehydrogenase was used. The cycle threshold (Ct) values were used to calculate relative changes in gene expression using the 2-ΔΔCt method.[25]

Western blotting analysis

Protein was extracted from L6 myotubes using RIPA buffer according to the manufacturer's protocol. The concentration of protein was measured by the Lowry method [26] using bovine serum albumin as the standard. Protein (20-100 μg: for GLUT1 100 μg, GLUT4 40 μg, and actin 20 μg) was separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and blotted onto polyvinylidene difluoride membranes by wet blotting overnight (30 volt at 4°C). The membrane was blocked with 5% skim milk and incubated overnight in 1:1000 primary antibody against actin, GLUT1 or GLUT4 at 4°C. The membrane was washed with tris-buffered saline with Tween 20 and blotted with HRP secondary antibody for 1 h. After incubation with ECL Western blotting substrate, the specific protein was detected using X-ray film (Kodak).

Statistical analysis

The experiments were performed in triplicate and presented as average ± standard deviation the significance between groups was determined using one-way ANOVA (IBM SPSS Statistics 23, USA) and in-group with Duncan's multiple range test. The difference between two groups was tested using the independent sample t-test. P < 0.05 and P < 0.01 were considered as indicating significant differences.


   Results Top


Identification of Astraeus fruiting bodies and characterization of the extracts

Although both Astraeus mushrooms were similar, they could be identified by physical appearances. The morphology of A. odoratus and A. asiaticus fruiting bodies and the microscopy of spores were in agreement with the literature,[12],[22] which confirmed the correct Astraeus species identification. TLC analysis of the ethanolic extract of both mushrooms and their hexane layer (AO and AA in this study) after spraying with 10% H2 SO4 showed red to purple color bands of compounds [Figure 1]b indicated the presence of triterpenoids. Moreover, TLC chromatogram of both Astraeus was clearly different under UV 254 nm from the two additional bands as shown in [Figure 1]a (arrows) which were observed in the extracts of A. odoratus [Figure 1] lane 1 and 3, compared to those of A. asiaticus [Figure 1] lane 2 and 4. Ergosterol was presented in all extracts of both mushrooms.
Figure 1: Thin-layer chromatography chromatogram of Astraeus odoratus and Astraeus asiaticus extracts. Thin-layer chromatography was detected under UV 254 nm (a); and by spraying with 10% H2SO4and heated (b). Two additional bands of Astraeus odoratus extracts were shown (arrows). Lane 1: 95% ethanolic extract of Astraeus odoratus; lane 2: 95% ethanolic extract of Astraeus asiaticus; lane 3: hexane layer of Astraeus odoratus or AO in this study; lane 4: hexane layer of Astraeus asiaticus or AA in this study; lane 5: ergosterol

Click here to view


HPLC chromatogram of the extracts from both Astraeus appeared similar patterns, which involved nearly the same significant peaks and contained ergosterol at retention time (RT) 62.8 min [Figure 2]. AO and AA, which were the hexane layers from ethanolic extracts demonstrated more proportion of the main peaks (RT 38.1–40.0 min) to the polar compounds (RT 11.0–22.1 min), which indicated the successive removal of those parts by the partitioning process.
Figure 2: HPLC chromatogram of the Astraeus extracts consisting of ergosterol as a biomarker. (a) ethanolic extract of Astraeus odoratus; (b) hexane layer from the ethanolic extract of Astraeus odoratus (AO in this study); (c) ethanolic extract of Astraeus asiaticus; (d) hexane layer from the ethanolic extract of Astraeus asiaticus (AA in this study); (e) ergosterol. The arrow in a-d was pointed at the peak of ergosterol

Click here to view


Glucose uptake of Astraeus odoratus and Astraeus asiaticus extracts

Glucose uptake is one of the main processes for lowering blood glucose, which occurs at 80% in muscle cells. In basal conditions, glucose uptake occurred normally and resulted in lower medium glucose. The reduction in medium glucose to a lower level than the basal level after the addition of AO and AA to L6 myotubes indicated the stimulation of glucose uptake activities of those extracts.

The results showed that AO and AA stimulated glucose uptake in a dose-dependent manner [Figure 3]. The concentration that decreased medium glucose to 50% lower than that of basal (EC50) for AO and AA was 81–144 μg/mL, whereas insulin, the positive control, had an EC50 of 6.6 nM. The dose-dependent range of AO and AA was 25–100 μg/mL and 12.5–200 μg/mL, respectively and reaching a plateau effect at 200–400 μg/mL. Increased cell viability (P < 0.01) was found at up to 200 μg/mL and 400 μg/mL of AO and AA, respectively. The time course of glucose uptake in L6 myotubes on the incubation of AO and insulin resulted in an increased percentage of glucose uptake in a time-dependent manner [Figure 4] and reached the maximum effect at 50 h. Therefore, AO 100 μg/mL and AA 200 μg/mL at the incubation time of 50 h were used for further studies.
Figure 3: Glucose uptake stimulation activities of Astraeus odoratus and Astraeus asiaticus extracts (AO and AA, respectively) (a) and % cell viability of L6 myotubes (b). *P <0.05; **P <0.01 versus basal, n = 3

Click here to view
Figure 4: Time course of glucose uptake to L6 myotubes by 200 μg/mL Astraeus odoratus extract (AO) and 50 nM insulin. **P <0.01 versus basal, n = 3

Click here to view


Effect of inhibitors on the glucose uptake activities of the extracts

To explain the mechanism of action related to that of insulin, inhibitors of the enzymes involved in the insulin signaling pathway, such as cytochalasin B, cycloheximide, wortmannin, and SB203580, were added to L6 myotubes in the presence of extracts at concentrations and times that did not cause a % cell viability <80% of basal. The reduction in glucose uptake in the presence of each inhibitor hence indicated the action of extracts involved with that enzyme. The results revealed partly different mechanisms for both extracts, as shown in [Figure 5]. The stimulation of glucose uptake by AO and AA was completely inhibited by cytochalasin B [Figure 5]c and obviously reduced by cycloheximide [Figure 5]e. Only AA action was reduced by wortmannin [Figure 5]a. The partial inhibition by SB203580 could be observed at the higher dose of AO and AA [Figure 5]b and [Figure 5]d. In summary, AO action was inhibited by cytochalasin B, cycloheximide, and SB203580, while AA action was significantly decreased by wortmannin, cytochalasin B, cycloheximide, and SB203580. These results indicated the enhancing of glucose uptake by AA and AO were included the function of glucose transporter type 1 and 4, which related to the increasing of their intrinsic activities via p38 MAPK and the synthesis of proteins involved in the glucose uptake processes. The mechanism of action of AA was related to PI-3K in addition.
Figure 5: Effects of specific inhibitors on the stimulation of the glucose uptake activity of Astraeus odoratus and Astraeus asiaticus extracts (AO and AA, respectively). L6 myotubes were treated with 100 μg/mL AO and 200 μg/mL AA (a-c, e) or 300 μg/mL AO and 400 ug/mL AA (d) and 50 nM insulin was used as positive control. (a) 3 μM Wortmannin was added after a 1 h treatment; (b and d) 20 μM SB203580 was added after treatment at 4 h; (c) 2 μM cytochalasin B was added after treatment at 4 h; and (e) 3.5 μM cycloheximide was added together with treatment. *P <0.05, **P <0.01 compared the activity without inhibitor versus with inhibitor; n = 3

Click here to view


Gene expression analysis of glucose transporter type 1 and glucose transporter type 4

At 50 h, the maximal glucose uptake stimulation was achieved from insulin, AO, and AA as 77.6%, 77.6%, and 76.9%. The upregulation of GLUT1 mRNA from the basal level (P < 0.01) was seen in insulin and AO, while that of AA was increased nonsignificantly [Figure 6]a. On the other hand, the mRNA level of GLUT4 of insulin, AO, and AA was lower than that of basal [Figure 6]b, which indicated the downregulation of GLUT4 expression after reaching very low glucose content in media. For basal, the glucose uptake process was still kept on going; therefore, the expression of both GLUT1 and GLUT4 was still presented.
Figure 6: mRNA expression of glucose transporter type 1 (a) and glucose transporter type 4 (b) in L6 myotubes. Glucose uptake stimulation at 50 h in the presence of 50 nM insulin, 100 μg/mL Astraeus odoratus extract (AO) and 200 μg/mL Astraeus asiaticus extract (AA) were 77.6%, 77.6% and 76.9%, respectively, higher than that of basal. **P <0.01 versus basal, n = 3

Click here to view


Western blot analysis

The protein level of GLUT1 and GLUT4 was detected at 50 h treatment of insulin, AO, and AA, which all of them provided the glucose uptake stimulation of 78%. The basal expression of GLUT4 protein, which was more intense than that of GLUT1 [Figure 7]a indicated a more abundant GLUT4 than GLUT1 in muscle cells. The increasing of both proteins intensities to those of basal were presented [Figure 7]b. The increasing of GLUT1 by insulin, AO, and AA was 32.9-, 9.6-, and 1.5-fold of basal, respectively, and the increasing of GLUT4 was 2.5-, 2.3-, and 2.3-fold of basal, respectively [Figure 7]c. The results were clearly indicated that the induction of GLUT1 and GLUT4 protein synthesis was due to insulin, AO, and AA, which AO gave more potent effects to GLUT1 synthesis than AA. The remained higher GLUT4 protein levels by insulin, AO and AA than that of basal, although the mRNA expression was downregulated [Figure 6]b suggested the stimulation of GLUT4 gene expression had occurred before detection time at 50 h and followed by induction of protein synthesis.
Figure 7: Glucose transporter type 1 and glucose transporter type 4 protein expression by insulin, Astraeus odoratus extract (AO) and Astraeus asiaticus extract (AA). Glucose uptake stimulation in the presence of 50 nM insulin, 100 μg/mL AO, and 200 μg/mL AA were 78.80%, 78.76%; and 78.4%, respectively, higher than that of basal. (a) Western blotting of glucose transporter type 1 and glucose transporter type 4 protein of basal and the treatments of 50 mM insulin, 100 μg/mL AO, and 200 μg/mL AA. Actin was used as a control. (b) Signal intensity of glucose transporter type 1 and glucose transporter type 4; (c) Signal intensity of glucose transporter type 1 and glucose transporter type 4 presented as fold of basal. **P < 0.01 versus basal glucose transporter type 1 at 50 h; ##P < 0.01 versus basal glucose transporter type 4 at 50 h; n = 3

Click here to view



   Discussion Top


Astraeus odoratus and A. asiaticus fruiting bodies have a very similar morphology and both of them have a closely phylogenetic relationship.[27] However, they could be differentiated by physical appearances and microscopy of spores. In this study, it was found that the TLC chromatogram under wavelength 254 nm revealed an interesting different pattern. The extracts from A. odoratus presented two clear additional bands which those from A. asiaticus did not have. Therefore, this method could be used to identify between these mushrooms fruiting bodies in the form of crude extract or powder.

TLC and HPLC chromatograms revealed the consisting of ergosterol as a biomarker of Astraeus extracts in this study [Figure 1]. Ergosterol possesses glucose uptake activity in L6 cells, enhancing GLUT4 translocation and upregulating GLUT4 expression and the phosphorylation of protein kinase B (Akt) and protein kinase C.[10] From our preliminary study, the hexane layer of partitioning ethanolic extract (AO and AA, respectively) had a more potent glucose uptake ability than their ethanolic parts; therefore, they were used in this study. The increasing of activities after the removal of higher polar components of the extracts suggested that the active compounds of both mushrooms might belong to less polar substances.

The reduction of glucose content in the basal medium in the presence of the extracts or insulin was interpreted as a glucose uptake stimulation effect of the samples. A time course for AO was performed to investigate the incubation time to reach the maximum glucose uptake of Astraeus extracts. Although the maximum accumulative reduction in medium glucose by AO was at 50 h, while that of insulin was at 40 h [Figure 4], the incubation time of 50 h was used in this study to achieve the highest effect for the Astraeus extracts. Since the chronic effect of insulin and tested samples has been reported after treatment for 6 h,[28] 12 h,[29] or 24 h to 72 h,[30] the incubation time of 50 h in this study might reflect the glucose uptake and mechanism of action of chronic exposure to insulin in muscle cells.

GLUT1 and GLUT4 are present in the insulin-sensitive tissues fat and muscle. GLUT1 functions in basal cellular activity, which requires a low level of glucose,[31],[32] while GLUT4 responds to insulin or other stimuli for higher levels of cellular glucose transport. Normally, GLUT1 is at very low abundance in muscle cells, whereas GLUT4 is much more expressed in this tissue,[18] which could also be seen from the Western blotting of protein extracts of untreated L6 myotubes in this study [Figure 7]a. The basal GLUT1 protein appeared as faint bands, but the GLUT4 protein band was very intense.

Since GLUT4 is related to the insulin response and GLUT1 is independent of insulin, AO might stimulate both insulin-dependent and insulin-independent mechanisms of glucose uptake while the major effect of AA was based on insulin-dependent action. This could also be confirmed by the slightly changed level of GLUT1 both mRNA expression and protein level, in the presence of AA [Figure 6]a and [Figure 7]c.

The higher GLUT1 protein level to that of basal which were detected by Western blotting were along with the upregulation of GLUT1 mRNA, whereas increasing of GLUT4 protein from basal was shown in contrast to downregulation of GLUT4 mRNA expression in the presence of insulin, AO, and AA. This could be explained that at 50 h incubation, glucose uptake took place until the culture medium was almost glucose-free, and hence, it was not available for further glucose uptake and therefore, the mRNA expression of GLUT4 was downregulated, whereas the non-insulin dependence continued to be stimulated by insulin and AO and AA as reflected by the higher mRNA level of GLUT1 compared to the basal level. The other possible reason was the effect of the chronic exposure of insulin, AO, and AA that led to a decrease in the mRNA expression of GLUT4. For the cells chronically treated with insulin, where glucose uptake reaches the maximum level at 50 h, the blockage of GLUT4 protein loss and reduction in the mRNA of GLUT4 were described.[29] The intense protein band of GLUT4 remained higher than that of the basal level [Figure 7]a and b], although the transcription process was already terminated because the half-life of GLUT4 protein (t1/2) is 18 h and after the reaching minimum point at 36 h, the GLUT4 protein level will rise again at 36–40 h and reach constantly at 50 h incubation.[33]

To investigate the insulin-dependent mechanisms of AO and AA, the glucose uptake levels for those extracts after the addition of specific inhibitors were determined. The optimal incubation time with inhibitors and their concentration that do not cause cell viabilities lower than 80% of basal levels were considered before the experiments. Based on previous knowledge, the glucose uptake activity of insulin was inhibited by all of the selected inhibitors in this study; that is, wortmannin, cytochalasin B, SB203580, and cycloheximide.

GLUT4 translocation in rat skeletal muscle, L6 muscle cells and 3T3-L1 adipocytes and the intrinsic activity of the translocated GLUT4 are essential to achieve the maximum glucose uptake by insulin.[34] Wortmannin inhibits glucose uptake through PI-3K, which is responsible for the translocation of glucose transporters to the plasma membrane.[35] Our results showed that AA activity could be inhibited by wortmannin, while it was not affected to that of AO. These results revealed that AA transports glucose through PI-3K.

SB 203580 is a selective p38 MAPK inhibitor. p38 MAPK responds to insulin, which results in the activation of transporter intrinsic activity in muscle cell culture as well as in rat skeletal muscle.[36] SB203580 decreases the glucose uptake of insulin by interfering with an insulin-derived signal that leads to activation of GLUT4[34] and decreases glucose uptake by insulin in 3T3-L1 adipocytes and L6 muscle cells.[37] The effect on glucose uptake by a Coccinia indica extract in L8 myotubes was also inhibited by SB203580.[38] In this study, SB203580 partially decreased the glucose uptake effect of insulin, AO and AA. Although the inhibitory effect on insulin [Figure 5] has been demonstrated as being unrelated to p38 MAPK inhibition,[39],[40] it might differ in the case of AO and AA. Therefore, it could be suggested that AO and AA partially activated the intrinsic activity of GLUT4 and might have a function related to p38 MAPK.

The lower level of glucose uptake by AO than that of insulin at the incubation time of 20 h [Figure 4] indicated the slower action and lack of an activated translocation effect but partially stimulated intrinsic effect,[41] in agreement with the noninhibitory effect of wortmannin [Figure 5]a and the partial inhibitory effect by SB203580 [Figure 5]d.

Cytochalasin B inhibits the insulin-dependent glucose transporter GLUT1 and GLUT4 activity,[42],[43],[44] and completely inhibits the glucose uptake function of insulin.[44] From our results, glucose uptake activities by insulin, AO, and AA were completely inhibited in the presence of cytochalasin B [Figure 5]c, which reflects glucose uptake through the function of GLUT1 and GLUT4. The percentage of stimulation of glucose uptake by L6 myotubes in the presence of cytochalasin B that were <0 indicated that the inhibition effects appeared until a greater medium glucose content than that of basal at 50 h was obtained. Since the basal level generated insulin-independent glucose uptake by GLUT1, therefore this result confirmed the inhibition of GLUT1 activity by cytochalasin B and indicated that glucose uptake also occurred in the basal (the untreated L6 myotubes).

Cycloheximide inhibits protein biosynthesis by the termination of peptide elongation in the protein translation process.[45],[46] From our results, the addition of 3.5 μM cycloheximide dramatically decreased the glucose uptake action of insulin, AO, and AA [Figure 5]e. This might result from suppressing the synthesis of some proteins [47] such as the insulin receptor, which is responsible at the initiation process of glucose uptake and the inactivation of the insulin receptor.[48]

In summary, the inhibition of glucose uptake by the specific inhibitors [Figure 5] demonstrated that the mechanism of action of AO and AA actions were driven through the increase in GLUT1 and GLUT4 proteins [Figure 7] and increased the intrinsic activity of GLUT4 through p38 MAPK. AA action is primarily mediated through GLUT4 by increasing protein synthesis and via PI-3K, which elicits the translocation of GLUT4 from within the cell to the plasma membrane. The results showed that AA provided a broader insulin-mimetic effect than AO.

There have been not many studies of the mechanism of action of mushrooms on glucose uptake and this is the first report for Astraeus extracts. The mushroom extracts that were previously characterized for the mechanism of glucose uptake include a G. lucidum methanolic extract, which stimulated glucose uptake through PI-3K and 5´ adenosine monophosphate-activated protein kinase;[49] and beta-glucan from Pleurotus sajor-caju (Fr.) Sing., which stimulated glucose uptake in L6 myotubes through PI-3K/Akt and p38 MAPK.[7] Both of these provided an action similar to that of AA.


   Conclusion Top


It has been confirmed that Astraeus odoratus and A. asiaticus possessed in vitro glucose uptake stimulation activity. The effects of both AO and AA occurred through the function of GLUT1 and GLUT4. They had slightly different mechanisms in that AO increased glucose uptake by the promotion of GLUT1 and GLUT4 synthesis and might be related to both insulin-dependent and insulin-independent pathways, while the effect of AA mainly involved GLUT4, which is related to the insulin-dependent pathway and revealed both inducing GLUT4 protein synthesis and increasing its activity through the translocation upon PI-3K. These results indicated the possibility of using both mushrooms for blood glucose lowering through glucose uptake stimulation. This will lead to added value for both mushrooms, especially A. asiaticus, for developing health products.

Finally, since both mushrooms are categorized as mycorrhizal species favorable to dipterocarpus trees such as Dipterocarpus alatus, Dipterocarpus tuberculatus, and Shorea roxburghii, the results from this study might be an inspiration to cultivate those trees to produce more Astraeus mushroom as a raw material for health products.

Acknowledgements

PP thanks the Faculty of Pharmaceutical Sciences, Khon Kaen University, Thailand, for the scholarship. NN thanks Khon Kaen University-National Research Council of Thailand (KKU-NRCT) for research funding (grant number 591101) and Mr. Sathaborn Kongdhama, Mr. Sorawit Chutjaroenpat, and Miss Katesaraporn Naunlkeaw.

Financial support and sponsorship

Faculty of Pharmaceutical Sciences, Khon Kaen University, Thailand, supported the scholarship for Miss Papawinee Phadannok. This work was funded by KKU-NRCT (grant number 591101).

Conflicts of interest

There are no conflicts of interest.



 
   References Top

1.
Chaudhury A, Duvoor C, Reddy Dendi VS, Kraleti S, Chada A, Ravilla R, et al. Clinical review of antidiabetic drugs: Implications for type 2 diabetes mellitus management. Front Endocrinol (Lausanne) 2017;8:6.  Back to cited text no. 1
    
2.
Phung OJ, Baker WL, Tongbram V, Bhardwaj A, Coleman CI. Oral antidiabetic drugs and regression from prediabetes to normoglycemia: A meta-analysis. Ann Pharmacother 2012;46:469-76.  Back to cited text no. 2
    
3.
Perera PK, Li Y. Functional herbal food ingredients used in type 2 diabetes mellitus. Pharmacogn Rev 2012;6:37-45.  Back to cited text no. 3
    
4.
Zhang HN, Lin ZB. Hypoglycemic effect of Ganoderma lucidumpolysaccharides. Acta Pharmacol Sin 2004;25:191-5.  Back to cited text no. 4
    
5.
Saiful I, Moyen UP. Antihyperglycemic activity of edible mushroom, Lentinusedodesin alloxan induced diabetic Swiss albino mice. Int J Pharm Clin Res 2014;6:121-6.  Back to cited text no. 5
    
6.
Biswas G, Acharya K. Hypoglycemic activity of ethanolic extract of Astraeus hygrometricus(Pers.) Morg. In: Alloxan-induced diabetic mice. Int J Pharm Pharm Sci 2013;5 Suppl 1:391-4.  Back to cited text no. 6
    
7.
Jantaramanant P, Sermwittayawong D, Noipha K, Towatana NH, Wititsuwannakul R. α-Glucan-containing polysaccharide extract from the grey oyster mushroom. Pleurotus sajor-caju(Fr.) Sing. stimulates glucose uptake by the L6 myotubes. Int Food Res J 2014;21:779-84.  Back to cited text no. 7
    
8.
Kiho T, Tsujimura Y, Sakushima M, Usui S, Ukai S. Polysaccharides in fungi. XXXIII. Hypoglycemic activity of an acidic polysaccharide (AC) from Tremella fuciformis. Yakugaku Zasshi 1994;114:308-15.  Back to cited text no. 8
    
9.
Li TH, Hou CC, Chang CL, Yang WC. Anti-hyperglycemic properties of crude extract and triterpenes from Poria cocos.Evid Based Complement Alternat Med 2011;2011. pii: 128402.  Back to cited text no. 9
    
10.
Xiong MX, Huang Y, Liu Y, Huang M, Song G, Ming Q, et al. Antidiabetic activity of ergosterol from Pleurotus ostreatusin KK-Ay mice with spontaneous type 2 diabetes mellitus. Mol Nutr Food Res 2018;62:1700444.  Back to cited text no. 10
    
11.
Pavithra M, Greeshma AA, Karun NC, Sridhar KR. Observations on the Astraeusspp. of Southwestern India. Mycosphere 2015;6:421-32.  Back to cited text no. 11
    
12.
Phosri C, Martín MP, Sihanonth P, Whalley AJ, Watling R. Molecular study of the genus Astraeus. Mycol Res 2007;111:275-86.  Back to cited text no. 12
    
13.
Arpha K, Phosri C, Suwannasai N, Mongkolthanaruk W, Sodngam S. Astraodoric acids A-D: New lanostane triterpenes from edible mushroom Astraeus odoratusand their anti-mycobacterium tuberculosis H37Ra and cytotoxic activity. J Agric Food Chem 2012;60:9834-41.  Back to cited text no. 13
    
14.
Srisurichan S, Piapukiew J, Puthong S, Pornpakakul S. Lanostane triterpenoids, spiro-astraodoric acid and astraodoric acids E and F, from the edible mushroom Astraeus odoratus. Phytochem Lett 2017;21:78-83.  Back to cited text no. 14
    
15.
Isaka M, Palasarn S, Srikitikulchai P, Vichai V, Komwijit S. Astreusins, A-L lanostane triterpenoids from the edible mushroom Astraeus odoratus. Tetrahedron 2016;72:3288-95.  Back to cited text no. 15
    
16.
Isaka M, Palasarn S, Sommai S, Veeranondha S, Srichomthong K, Kongsaeree P, et al. Lanostane triterpenoids from the edible mushroom Astraeus asiaticus.Tetrahedron 2017;73:1561-7.  Back to cited text no. 16
    
17.
Pimjuk P, Phosri C, Wauke T, McCloskey S. The isolation of new lanostane triterpenoid derivatives from the edible mushroom Astraeus asiaticus. Phytochem Lett 2015;14:79-83.  Back to cited text no. 17
    
18.
Kahn BB. Facilitative glucose transporters: Regulatory mechanisms and dysregulation in diabetes. J Clin Invest 1992;89:1367-74.  Back to cited text no. 18
    
19.
Furtado LM, Somwar R, Sweeney G, Niu W, Klip A. Activation of the glucose transporter GLUT4 by insulin. Biochem Cell Biol 2002;80:569-78.  Back to cited text no. 19
    
20.
Kumar K. Role of edible mushroom as functional foods - A review. South Asian J Food Technol Environ 2015;1:211-8.  Back to cited text no. 20
    
21.
Reis FS, Martins A, Vasconcelos MH, Morales P, Ferreira IC. Functional foods based on extracts or compounds derived from mushrooms. Trends Food Sci Technol 2017;66:48-62.  Back to cited text no. 21
    
22.
Phosri C, Watling R, Martin MP, Whalley AJ. The genus Astraeusin Thailand. Mycotaxon 2004;89:453-63.  Back to cited text no. 22
    
23.
Leonard LM. Melzer's, Lugol's or iodine for identification of white-spored Agaricales? McIlvainea 2006;16:43-51.  Back to cited text no. 23
    
24.
Mosmann T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J Immunol Methods 1983;65:55-63.  Back to cited text no. 24
    
25.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 2001;25:402-8.  Back to cited text no. 25
    
26.
Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the folin phenol reagent. J Biol Chem 1951;193:265-75.  Back to cited text no. 26
    
27.
Phosri C, Martín MP, Watling R. Astraeus: Hidden dimensions. IMA Fungus 2013;4:347-56.  Back to cited text no. 27
    
28.
Ma J, Nakagawa Y, Kojima I, Shibata H. Prolonged insulin stimulation down-regulates GLUT4 through oxidative stress-mediated retromer inhibition by a protein kinase CK2-dependent mechanism in 3T3-L1 adipocytes. J Biol Chem 2014;289:133-42.  Back to cited text no. 28
    
29.
Thomson MJ, Williams MG, Frost SC. Development of insulin resistance in 3T3-L1 adipocytes. J Biol Chem 1997;272:7759-64.  Back to cited text no. 29
    
30.
Sargeant RJ, Pâquet MR. Effect of insulin on the rates of synthesis and degradation of GLUT1 and GLUT4 glucose transporters in 3T3-L1 adipocytes. Biochem J 1993;290(Pt 3):913-9.  Back to cited text no. 30
    
31.
Zorzano A, Wilkinson W, Kotliar N, Thoidis G, Wadzinkski BE, Ruoho AE, et al.Insulin-regulated glucose uptake in rat adipocytes is mediated by two transporter isoforms present in at least two vesicle populations. J Biol Chem 1989;264:12358-63.  Back to cited text no. 31
    
32.
Marette A, Richardson JM, Ramlal T, Balon TW, Vranic M, Pessin JE, et al.Abundance, localization, and insulin-induced translocation of glucose transporters in red and white muscle. Am J Physiol 1992;263:C443-52.  Back to cited text no. 32
    
33.
Flores-Riveros JR, McLenithan JC, Ezaki O, Lane MD. Insulin down-regulates expression of the insulin-responsive glucose transporter (GLUT4) gene: Effects on transcription and mRNA turnover. Proc Natl Acad Sci U S A 1993;90:512-6.  Back to cited text no. 33
    
34.
Konrad D, Bilan PJ, Nawaz Z, Sweeney G, Niu W, Liu Z, et al.Need for GLUT4 activation to reach maximum effect of insulin-mediated glucose uptake in brown adipocytes isolated from GLUT4myc-expressing mice. Diabetes 2002;51:2719-26.  Back to cited text no. 34
    
35.
Okada T, Kawano Y, Sakakibara T, Hazeki O, Ui M. Essential role of phosphatidylinositol 3-kinase in insulin-induced glucose transport and antilipolysis in rat adipocytes. Studies with a selective inhibitor wortmannin. J Biol Chem 1994;269:3568-73.  Back to cited text no. 35
    
36.
Rudich A, Klip A. Push/pull mechanisms of GLUT4 traffic in muscle cells. Acta Physiol Scand 2003;178:297-308.  Back to cited text no. 36
    
37.
Somwar R, Perreault M, Kapur S, Taha C, Sweeney G, Ramlal T, et al.Activation of p38 mitogen-activated protein kinase alpha and beta by insulin and contraction in rat skeletal muscle: Potential role in the stimulation of glucose transport. Diabetes 2000;49:1794-800.  Back to cited text no. 37
    
38.
Purintrapiban J, Kaewpradub N, Jansakul C. Role of Coccinia indicain muscle glucose transport. Songklanakarin J Sci Technol 2006;28:1199-208.  Back to cited text no. 38
    
39.
Turban S, Beardmore VA, Carr JM, Sakamoto K, Hajduch E, Arthur JS, et al.Insulin-stimulated glucose uptake does not require p38 mitogen-activated protein kinase in adipose tissue or skeletal muscle. Diabetes 2005;54:3161-8.  Back to cited text no. 39
    
40.
Antonescu CN, Huang C, Niu W, Liu Z, Eyers PA, Heidenreich KA, et al.Reduction of insulin-stimulated glucose uptake in L6 myotubes by the protein kinase inhibitor SB203580 is independent of p38MAPK activity. Endocrinology 2005;146:3773-81.  Back to cited text no. 40
    
41.
Noipha K, Ratanachaiyavong S, Purintrapiban J, Herunsalee A, Ninla-aesong P. Effect of Tinospora crispaon glucose uptake in skeletal muscle: Role of glucose transporter 1 expression and extracellular signal-regulated kinase1/2 activation. Asian Biomed 2011;5:361-9.  Back to cited text no. 41
    
42.
Ebstensen RD, Plagemann PG. Cytochalasin B: Inhibition of glucose and glucosamine transport. Proc Natl Acad Sci U S A 1972;69:1430-4.  Back to cited text no. 42
    
43.
Kapoor K, Finer-Moore JS, Pedersen BP, Caboni L, Waight A, Hillig RC, et al.Mechanism of inhibition of human glucose transporter GLUT1 is conserved between cytochalasin B and phenylalanine amides. Proc Natl Acad Sci U S A 2016;113:4711-6.  Back to cited text no. 43
    
44.
Ryder JW, Kawano Y, Chibalin AV, Rincón J, Tsao TS, Stenbit AE, et al.In vitroanalysis of the glucose-transport system in GLUT4-null skeletal muscle. Biochem J 1999;342(Pt 2):321-8.  Back to cited text no. 44
    
45.
Jones TL, Cushman SW. Acute effects of cycloheximide on the translocation of glucose transporters in rat adipose cells. J Biol Chem 1989;264:7874-7.  Back to cited text no. 45
    
46.
Schneider-Poetsch T, Ju J, Eyler DE, Dang Y, Bhat S, Merrick WC, et al.Inhibition of eukaryotic translation elongation by cycloheximide and lactimidomycin. Nat Chem Biol 2010;6:209-17.  Back to cited text no. 46
    
47.
Sorrentino V, Battistini A, Curatola AM, Di Francesco P, Rossi GB. Induction and/or selective retention of proteins in mammalian cells exposed to cycloheximide. J Cell Physiol 1985;125:313-8.  Back to cited text no. 47
    
48.
Knutson VP, Ronnett GV, Lane MD. The effects of cycloheximide and chloroquine on insulin receptor metabolism. Differential effects on receptor recycling and inactivation and insulin degradation. J Biol Chem 1985;260:14180-8.  Back to cited text no. 48
    
49.
Jung KH, Ha E, Kim MJ, Uhm YK, Kim HK, Hong SJ, et al.Ganoderma lucidumextract stimulates glucose uptake in L6 rat skeletal muscle cells. Acta Biochim Pol 2006;53:597-601.  Back to cited text no. 49
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7]



 

Top
   
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Introduction
    Materials and Me...
   Results
   Discussion
   Conclusion
    References
    Article Figures

 Article Access Statistics
    Viewed103    
    Printed0    
    Emailed0    
    PDF Downloaded23    
    Comments [Add]    

Recommend this journal